Call Us Today! 1-855-835-7172|sales@intactgenomics.com

FastAmp® Plant Cell Lysis Solution (1x)

$198.00

FastAmp® Plant Cell Lysis Solution (1x) for is designed for rapid cell lysis and DNA separation simultaneously without the need of DNA extraction.


    20 mL - $198.00 (Cat.# 4611 )

Category: .

Description

FastAmp® Plant Cell Lysis Solution (1x) is designed for rapid cell lysis and DNA separation simultaneously without the need for DNA extraction steps. It contains very low concentrations of less toxic chemicals for direct DNA amplification of genomic DNA from various plant tissues. No heat treatment and no termination buffer is is required, saving significant time. FastAmp® Plant Cell Lysis Solution (1x) has been optimized with FastAmp® Plant Direct PCR kit and FastAmp® Plant Tissue/Seed Genotyping PCR kit.

Highlights

  • Simple DNA Preparation—No DNA extraction is needed
  • Fast Protocol—Tissue lysis/Genomic DNA ready for PCR in 3 min
  • Contains non-toxic solutions for lysis and DNA preparation
  • Simple to use for single tube Multiplexing (single tube, tube strips, 96-well, or 384-well )
  • Save significant time and funding (no bead or spin column, minimal hands-on time )
  • Consistent results

 Product Includes

  • FastAmp® Plant Cell Lysis Solution (1x)

Storage Temperature
Room Temperature

Quality Control Assays

FastAmp® Plant Cell Lysis Solution (1x) has been tested via Direct PCR analysis from various plant tissues, some of the results are included here.  QC Data from various tissue below:

FastAmp® Solution Maize and Soy

FastAmp® Plant Solution Rice and CottonLane 1:  25µl Buffer/5mmx5mm Leaf Tissue
Lane 2:  25µl Buffer/5mmx5mm Leaf Tissue
Lane 3:  25µl Buffer/5mmx5mm Leaf Tissue
Lane 4:  25µl Buffer/5mmx5mm Leaf Tissue
Control Primer F – AGTTCGAGCCTGATTATCCC
Control Primer R – GCATGCCGCCAGCGTTCATC

 

Technical Support

Intact Genomics is committed to supporting the worldwide scientific research community by supplying the highest quality reagents. Each new lot of our products is tested to ensure they meet the quality standards and specifications designated for the product. Please follow the instructions carefully and contact us if additional assistance is needed. We appreciate your business and your feedback regarding the performance of our products in your applications.

4611

Additional information

mL

20 mL

General Guidelines before start
A. Sample handling

5mm x 5mm cut leaf tissue or 2mg seed powder should be placed in 20µl of FastAmp®  Plant Direct PCR/Genotyping Solution. Then the sample should be mixed thoroughly and incubated at room temperature for 5min. No need to heat the sample to lysis tissue.

B. PCR conditions
B-1 Denaturation:

An initial denaturation of 8 minutes at 95°C is sufficient for most amplicons. Longer denaturation times can be used (up to 8 minutes) for difficult templates.  During thermocycling, the denaturation step should be kept to a minimum. Typically, a 20–30 second denaturation at 95°C is recommended for most templates.

B-2 Annealing:

Optimize the annealing temperatures for the target gene specific amplification by keeping annealing temperature at least 5 ºC below Tm values. Typically, use a 10–30 second annealing step. A temperature gradient can also be used to optimize the annealing temperature for each primer pair.

B-3 Extension:

The recommended extension temperature is 72°C. Extension times are generally 1 minute per kb for complex, genomic samples, but can be reduced to 30 seconds per kb for simple templates. When amplifying products >2 kb, it is often helpful to increase the extension time.

A final extension of 5 minutes at 72°C is recommended.

B-4 Cycle number:
Generally, 35–40 cycles yield sufficient product.

B-5 Primers:

Forward and reverse primers are generally used at the final concentration of 0.1-0.6 µM each. If the primer
concentration is too high, the specificity of priming may be reduced, resulting in non-specific products.

B-6 PCR product:
The PCR products generated using Taq DNA Polymerase have dA ends. If cloning is the next step, then T/A-cloning is preferred.

Protocol

  1. Thaw 2x master mix, Plant Direct PCR/Genotyping Solution, primers and mix thoroughly and spin down before use.
  2. Cut 5mm x 5mm leaf tissue in 1.5ml tube or 96 well plate and add 20µl  FastAmp® Direct PCR/Genotyping Solution and mix thoroughly
  3. Prepare a reaction mix according to the following table:FastAmp Genotyping Kit PCR Reaction Set Up
  4. Mix the reaction mixture thoroughly.
  5. Program the thermal cycler according to the manufacturer’s instructions. A typical PCR cycling program is outlined in the following table.
    Plant Direct PCR Cycling Conditions
  6. Place the PCR tubes in the thermal cycler and start the cycling program.
  7. Run 10.0 µl of PCR products in 1% agarose gel (140 volts for 45 min).

Troubleshooting

Plant Direct PCR Troubleshooting low product yield

Plant Direct PCR Troubleshooting Non-specific Products

FastAmp® Plant Cell Lysis Solution Manual

FastAmp® Plant Cell Lysis Solution MSDS

Title

Go to Top