Call Us Today! 1-855-835-7172|sales@intactgenomics.com

FastAmp® Plant Tissue & Seed Genotyping Kit

$169.00$575.00

FastAmp® Plant Tissue & Seed Genotyping Kit is suitable for amplification of DNA directly from plant samples without purifying DNA.


    250 Reactions - $169.00 (Cat.# 4617 )

    1000 Reactions - $575.00 (Cat.# 4619 )

Category: .

Description

FastAmp® Plant Tissue & Seed Genotyping Kit is suitable for amplification of DNA directly from plant samples without purifying DNA. This kit is based on specially engineered Taq DNA polymerase, proprietary buffer system, dNTP, MgCl2, PCR facilitators and dye mix which makes it extremely robust and tolerant of plant PCR inhibitors such as complex polysaccharides, polyphenols and others. This PCR master mix has been tested with leaves and seeds from a wide variety of plant species. This kit includes a complete set of optimized reagents and detailed protocols making it an ideal choice for high-throughput genotyping from various Plant tissue/seeds without DNA purification steps .

Plant Direct PCR

Highlights

  • Direct PCR- no need to purify DNA
  • Specially engineered Taq DNA polymerase with highest sensitivity and specificity
  • Extremely short PCR protocol times
  • Master mix format with premixed gel loading dye to reduce cross-contamination and sample handling
    errors
  • Optimized for both low and high GC templates

Applications

  • Genotyping
  • Transgene detection
  • Knockout analysis
  • Sequencing

 Product Includes

  • FastAmp® Plant Direct PCR master mix (2x)
  • FastAmp® Plant Direct PCR/Genotyping Solution

Storage Temperature
20ºC

Quality Control Assays

FastAmp® Plant Tissue/Seed Genotyping Kit has been tested with tissue from a wide variety of plant species, some of the results are included here.

FastAmp Genotyping KitMaterial: Plant Leaf
Control Primer F – AGTTCGAGCCTGATTATCCC
Control Primer R – GCATGCCGCCAGCGTTCATC

Genotyping PCR analysis from Plant leaf tissue in 96 plate using FastAmp® Plant Tissue/Seed Genotyping PCR kit

Additional information

Reactions

250 Reactions, 1000 Reactions

General Guidelines before start
A. Sample handling

5mm x 5mm cut leaf tissue or 2mg seed powder should be placed in 20µl of FastAmp®  Plant Direct PCR/Genotyping Solution. Then the sample should be mixed thoroughly and incubated at room temperature for 5min. No need to heat the sample to lyse the tissue.

B. PCR conditions
B-1 Denaturation:

An initial denaturation of 8 minutes at 95°C is sufficient for most amplicons. Longer denaturation times can be used (up to 10 minutes) for difficult templates.  During thermocycling, the denaturation step should be kept to a minimum. Typically, a 20–30 second denaturation at 95°C is recommended for most templates.

B-2 Annealing:

Optimize the annealing temperatures for the target gene specific amplification by keeping annealing temperature at least 5 ºC below Tm values. Typically, use a 10–30 second annealing step. A temperature gradient can also be used to optimize the annealing temperature for each primer pair.

B-3 Extension:

The recommended extension temperature is 72°C. Extension times are generally 1 minute per kb for complex genomic samples but this can be reduced to 30 seconds per kb for simple templates. When amplifying products >2 kb, it is often helpful to increase the extension time.

A final extension of 5 minutes at 72°C is recommended.

B-4 Cycle number:
Generally, 35–40 cycles yield sufficient product.

B-5 Primers:

Forward and reverse primers are generally used at the final concentration of 0.1-0.6 µM each. If the primer
concentration is too high, the specificity of priming may be reduced, resulting in non-specific products.

B-6 PCR product:
The PCR products generated using Taq DNA Polymerase have dA ends. If cloning is the next step, then T/A-cloning is preferred.

Protocol

  1. Thaw 2x master mix, Plant Direct PCR/Genotyping Solution, primers and mix thoroughly and spin down before use.
  2. Cut 5mm x 5mm leaf tissue in 1.5ml tube or 96 well plate and add 20µl  FastAmp® Direct PCR/Genotyping Solution and mix thoroughly
  3. Prepare a reaction mix according to the following table:Plant Genotyping Kit PCR Reaction Set up
  4. Mix the reaction mixture thoroughly.
  5. Program the thermal cycler according to the manufacturer’s instructions. A typical PCR cycling program is outlined in the following table.
    Plant Genotyping Kit PCR Cycling Conditions
  6. Place the PCR tubes in the thermal cycler and start the cycling program.
  7. Run 10.0 µl of PCR products in 1% agarose gel (120 volts for 45 min).

Troubleshooting

Plant Direct PCR Troubleshooting low product yield

Plant Direct PCR Troubleshooting Non-specific Products

FastAmp® Plant Tissue Seed Genotyping Kit Manual

Go to Top